|
ATCC
gene names Gene Names, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene names/product/ATCC Average 92 stars, based on 1 article reviews
gene names - by Bioz Stars,
2026-06
92/100 stars
|
Buy from Supplier |
|
Endra Life Sciences
gene name endra Gene Name Endra, supplied by Endra Life Sciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene name endra/product/Endra Life Sciences Average 86 stars, based on 1 article reviews
gene name endra - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Cell Signaling Technology Inc
antibody information gene name Antibody Information Gene Name, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/antibody information gene name/product/Cell Signaling Technology Inc Average 86 stars, based on 1 article reviews
antibody information gene name - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Biotechnology Information
gene names Gene Names, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene names/product/Biotechnology Information Average 86 stars, based on 1 article reviews
gene names - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Qiagen
n instrument name N Instrument Name, supplied by Qiagen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/n instrument name/product/Qiagen Average 94 stars, based on 1 article reviews
n instrument name - by Bioz Stars,
2026-06
94/100 stars
|
Buy from Supplier |
|
Biotechnology Information
gene named succinate dehydrogenase c sdhc Gene Named Succinate Dehydrogenase C Sdhc, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene named succinate dehydrogenase c sdhc/product/Biotechnology Information Average 86 stars, based on 1 article reviews
gene named succinate dehydrogenase c sdhc - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
ATCC
strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id Strain Gene Name Accession Polypeptide Arthrobacter Aurescens Dsm Hyuc Seq Id, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id/product/ATCC Average 90 stars, based on 1 article reviews
strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |
|
Cusabio
b kit name human calcitonin gene related peptide B Kit Name Human Calcitonin Gene Related Peptide, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/b kit name human calcitonin gene related peptide/product/Cusabio Average 93 stars, based on 1 article reviews
b kit name human calcitonin gene related peptide - by Bioz Stars,
2026-06
93/100 stars
|
Buy from Supplier |
|
Wolters Kluwer Health
gene name base pair primer sequence annealing temp Gene Name Base Pair Primer Sequence Annealing Temp, supplied by Wolters Kluwer Health, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/gene name base pair primer sequence annealing temp/product/Wolters Kluwer Health Average 86 stars, based on 1 article reviews
gene name base pair primer sequence annealing temp - by Bioz Stars,
2026-06
86/100 stars
|
Buy from Supplier |
|
Oligos Etc
oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10) Oligo Gene Name Sequence (5’ 3’) Gyra Gyra For Ttgaaggaggaactcttgatgg (Seq Id No: 10), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)/product/Oligos Etc Average 90 stars, based on 1 article reviews
oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10) - by Bioz Stars,
2026-06
90/100 stars
|
Buy from Supplier |