Review





Similar Products

92
ATCC gene names
Gene Names, supplied by ATCC, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene names/product/ATCC
Average 92 stars, based on 1 article reviews
gene names - by Bioz Stars, 2026-06
92/100 stars
  Buy from Supplier

86
Endra Life Sciences gene name endra
Gene Name Endra, supplied by Endra Life Sciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene name endra/product/Endra Life Sciences
Average 86 stars, based on 1 article reviews
gene name endra - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Cell Signaling Technology Inc antibody information gene name
Antibody Information Gene Name, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/antibody information gene name/product/Cell Signaling Technology Inc
Average 86 stars, based on 1 article reviews
antibody information gene name - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

86
Biotechnology Information gene names
Gene Names, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene names/product/Biotechnology Information
Average 86 stars, based on 1 article reviews
gene names - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

94
Qiagen n instrument name
N Instrument Name, supplied by Qiagen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/n instrument name/product/Qiagen
Average 94 stars, based on 1 article reviews
n instrument name - by Bioz Stars, 2026-06
94/100 stars
  Buy from Supplier

86
Biotechnology Information gene named succinate dehydrogenase c sdhc
Gene Named Succinate Dehydrogenase C Sdhc, supplied by Biotechnology Information, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene named succinate dehydrogenase c sdhc/product/Biotechnology Information
Average 86 stars, based on 1 article reviews
gene named succinate dehydrogenase c sdhc - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
ATCC strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id
Strain Gene Name Accession Polypeptide Arthrobacter Aurescens Dsm Hyuc Seq Id, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id/product/ATCC
Average 90 stars, based on 1 article reviews
strain gene name accession polypeptide arthrobacter aurescens dsm hyuc seq id - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

93
Cusabio b kit name human calcitonin gene related peptide
B Kit Name Human Calcitonin Gene Related Peptide, supplied by Cusabio, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/b kit name human calcitonin gene related peptide/product/Cusabio
Average 93 stars, based on 1 article reviews
b kit name human calcitonin gene related peptide - by Bioz Stars, 2026-06
93/100 stars
  Buy from Supplier

86
Wolters Kluwer Health gene name base pair primer sequence annealing temp
Gene Name Base Pair Primer Sequence Annealing Temp, supplied by Wolters Kluwer Health, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gene name base pair primer sequence annealing temp/product/Wolters Kluwer Health
Average 86 stars, based on 1 article reviews
gene name base pair primer sequence annealing temp - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

90
Oligos Etc oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)
Oligo Gene Name Sequence (5’ 3’) Gyra Gyra For Ttgaaggaggaactcttgatgg (Seq Id No: 10), supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10)/product/Oligos Etc
Average 90 stars, based on 1 article reviews
oligo gene name sequence (5’---3’) gyra gyra_for ttgaaggaggaactcttgatgg (seq id no: 10) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier

Image Search Results